Journal: Bone Marrow Transplantation

Article Title: Brief ex vivo Fas-ligand incubation attenuates GvHD without compromising stem cell graft performance

doi: 10.1038/s41409-020-0941-2

Figure Lengend Snippet: T-lymphocytes isolated from FasL-treated and control MPBCs were stimulated using anti-CD3/CD28 activation beads. a Activated T helper (CD4 + CD25 + ) and b T cytotoxic (CD8 + CD25 + ) cells were quantified 24 and 48 h post stimulation using flow cytometry. c Concentration of IFN-γ secreted to the medium of the cultured T-cells was measured 24, 48 and 72 h post stimulation using ELISA. d The percentages of CD4 + and CD8 + IFN-γ secreting (IFN-γ + ) cells were quantified by flow cytometry 48 h post stimulation. e Percent of TH1 (CD4 + CXCR3 + ) and f TC1 (CD8 + CXCR3 + ) cells were quantified 24 and 48 h post stimulation using flow cytometry. g The percentages of CD4 + and CD8 + IL17 secreting (IL17 + ) cells were quantified by flow cytometry 48 h after stimulation. h TH17 (CD4 + CCR6 + ) T cells populations were quantified 24 and 48 h post stimulation using flow cytometry. i Regulatory CD4 + and CD8 + T cells (CD25 + FoxP3 + ) were quantified 72 h post stimulation using flow cytometry. Representative results of one independent study out of two is presented. Data presented as Mean+SD, n = 3. Statistical analysis was performed using unpaired, parametric t-test; * P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001.

Article Snippet: Intracellular staining was performed using either Inside Stain Kit or FoxP3 Staining Buffer Set (130-090-477 or 130-093-142, respectively, Miltenyi Biotech, Bergisch Gladbach, Germany) according to manufacturer’s instructions.

Techniques: Isolation, Control, Activation Assay, Flow Cytometry, Concentration Assay, Cell Culture, Enzyme-linked Immunosorbent Assay

Journal: Cell reports

Article Title: The splicing isoform Foxp3Δ2 differentially regulates tTreg and pTreg homeostasis.

doi: 10.1016/j.celrep.2023.112877

Figure Lengend Snippet: Figure 1. Deletion of exon 2 of Foxp3 results in stronger DNA binding (A) The functional domains of Foxp3. Domains are represented by different colors: N181 (cyan), exon 2 (blue), zinc finger (yellow), leucine zipper (magenta), FKH (red), and others (green). (B) Protein structure of Foxp3 and Foxp3D2 based on AlphaFold2. The colors of the different domains in the structure correspond to (A). (C) Foxp3 and targeted DNA based on AlphaFold2. (D) Flow cytometry analysis of the percentage of FRET-positive cells after overexpression of Foxp3 or Foxp3D2 fused with CFP at the N terminus and YFP at the C terminus. CFP- and YFP-overex- pressed 293T cells were negative control, and CFP-YFP-overexpressed 293T cells were positive control. (E) Quantification of the results in (D). (F) Analysis of the DNA-binding capability of Foxp3 or its mutants by comparing the ratio of firefly luciferase to Renilla luciferase.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Superscript III Reverse Transcriptase Invitrogen 18080044 UltraSYBG Mixture CWBIO 04707494001 RiboLock RNase Inhibitor Thermo Fisher CW0957L Protease inhibitor Roche 05892791001 Phorbol 12-myristate 13-acetate (PMA) Sigma P8139 Ionomycin Sigma I0634 Monensin BioLegend 420701 Critical commercial assays RNeasy MicroRNA Kit QIAGEN 74004 Foxp3 Staining Buffer Set eBioscience 00-5523-00 CellTrace Violet Proliferation Kit Invitrogen C34557 Deposited data RNAseq from Spleen and LNs This paper GSE208094 RNAseq from cLP This paper GSE208370 Foxp3 CUT&Tag This paper GSE236356 Experimental models: Cell lines HEK293T ATCC Cat # CRL-3216 B16F10 ATCC Cat # CRL-6475 Experimental models: Organisms/strains C57BL/6 mice HuaFuKang N/A Foxp3GFP Cre Previous study Zhou et al.37 Foxp3DCNS1 cre-Thy1.1 Previous study Zhang et al.29 Rosa26LSL-YFP Previous study Shankar Srinivas et al.38 Foxp3-RFP Previous study Wan et al.39 Foxp3D2 This paper N/A Oligonucleotides GTCTCACACGGTAGCAACAA (exon2 sgRNA1) This paper Sangon Biotech ATCAGGTATGGAATCGGAGC (exon2 sgRNA2) This paper Sangon Biotech Recombinant DNA px330 Addgene 42230 Software and algorithms FlowJo 10 Tree Star https://www.flowjo.com/ Prism 8 Graphpad Software https://www.graphpad.com/ PyMOL DeLano Scientific LLC https://pymol.org/2/

Techniques: Binding Assay, Functional Assay, Flow Cytometry, Over Expression, Negative Control, Positive Control, Luciferase